El póster de Fall out boy

Por | 23 Mar 06, 14:11

petemozz.jpg

Fall Out Boy es una de esas bandas de rock americano que, por suerte, ya no llegan a España. Su disco ‘Under the cock cork’ se ha vendido muy bien en EE.UU. aunque en las últimas semanas había empezado a caer en las listas. Sin embargo esta semana sus ventas han aumentado un 122%, subiendo del puesto 42 al 9. La explicación oficial es la reedición del disco. Pero estoy seguro de que la filtración de estas fotos del bajista (el tercero que recuerdo en bolas después de Flea y Adam Clayton) también ha contribuido. En un comunicado de su web ha dicho: “Si no quieres que se filtren fotos tuyas desnudo, no te las hagas”.

Ahora, ni ventas ni pollas. A nosotros lo que nos interesa es… ¡ese póster de Morrissey de la primera foto! Morrissey, if you’re reading this, and considering some of your covers and lyrics, we think these pics they really fit you. Hope you enjoy them!

  • Hombre, queda bien Morrissey. Pero algo de los Hidden Cameras hubiese sido mucho más acertado, ¿no? Seguro que a Joel Gibb le hubiese encantado verse en semejante situación :D

  • Voy corriendo a por la cámara a hacerme una foto del ojete en pelotas, con un poster de Marilyn Manson detrás. A ver si así me compran el blog algún fan satánico.
    :-D :-P

  • Sí, los Hidden más pero Mozz tb. Para el que no lo sepa, los Smiths cogieron una foto de Joe Dalessandro para la portada de su primer disco, y una foto de una estrella de porno gay, amiga de Divine, para la portada del single Hand in glove.

  • Sr. Varoa

    Por dios que asco.

  • ¿Dónde se puede encontrar más información sobre ese joven?

  • Peasso posha, tú… Triste que alguien venda más discos gracias a enseñarla, no?

    Abrazos.

  • Se la está estirando, claramente.

    Morrissey estará encantado.

  • javiprat

    Lo mejor es que tiene la foto de Morrissey en el lavabo. Bueno, él salía bañándose en el video del Suedehead con un póster enorme de James Dean sobre la bañera, aunque no se tocaba.

  • angel

    Que bien estos “adolescentes con picores” americanos.Pues si hay que comprarse el cd de un grupo por el tamaño de la polla del bajista o por si esta bueno el cantante… nada,nada, voy a comprarme los discos de la Aguilera, J. Lo y la H. duff (uy, no, que esta es menor de edad y luego te dicen pederasta y esas cosas ;)

  • Hombre, si es cuestión de tamaño, yo te recomiendo a Dolly Parton. :p

  • rafel

    A mi es que los pubis afeitados como que no. Eso sí el poster de Morrissey genial.

  • Yo creo que no está afeitado. Es que los guiris son así.

  • paolo

    Se dice que Morrissey en USA cuenta entre sus fans no a los tipicos “sensitive indie-kids” (que algunos habra) y a los tipicos britofilos a:

    * Amas de casa del Midwest (Musicalmente encaja con sus baladones)
    * Chicanos de bandas de California (Claro homenaje y guiño en “The first of the gang to die”)
    * Hardcoretas con identidad sexual confusa (Y quien no la tiene)

    Os juro que esto lo lei hace muchos años en un NME…

  • u.u no no lo puedo kreer ke sea pete!

  • Elena Wentz

    1º El disco se llama ‘From Under The Cork Tree’.

    2º Si FOB ha vendido más discos no ha sido xk el bajista de la banda se haya exo esas fotos, a ver ke gilipoyas se compra el cd xk sale uno enseñando las bolas.

    3º Ke pasa ke no habeis visto a nadie en pelotas o ke? xDDD Osea ke fuerte ke asco ke me da x’D.

    4º Sí, es Pete.

  • Sabrina Wentz

    No estoy de aduerdo con lo que dices, en absoluto!
    ¿Cómo que por suerte FOB es un grupo que no llega a España???¿Cómo que gracias a esas fotos han vendido más??
    Por suerte hay gente en España que conoce a FOB, entre la que me incluyo, y no, no me compré el disco por ver a Pete desnudo, me lo compre xq simplemente me gusta su musica, jaja ¿realmente crees q alguien se comprea un disco xq salga un integrante salga en bolas? tú lo haces o qué?por mucho q saliese bisbal en bolas no me compraba su disco(ni sikiera pirata)aggg jaja
    Asi que, si FALL OUT BOY vende discos, quizás será xq son buenos?????
    no se…. te recomiendo q escuches el disco “FROM UNDER THE CORK TREE” o los discos anteriore.
    un saludín

  • A mi me gusta este chico, pero se ve que estan muy necesitados como para poner al bajista a pelarse la verga

  • carlos

    pues la verdad a mi me da igual si esta asi o no a mi me gusta su musica y punto…

  • moNI

    da asco pero ,fall out boy esta muy padre y no solo por las fotos se venden discos ,es por la música.

  • uuu q asco me trumo kon una amiga estamos mas truma q la xuxa ya na mas q decir y q asco pero el es super riko

  • Miguel

    la tiene muy rica, me gustaría mamarsela, y a los que quieran con el poster de FOB de fondo. malcom41 de hotmail.

  • ME PARECE DEMASIADA BUENA EL POSTER EL MIEMBRO ES IGUAL DE GRANDE COMO EL MIO MUY BIEN MUCHACHON SABROSO

  • que bien!!!! ahora quiero que los demas integrantes de la banda hagan lo mismo!!!

  • cami

    es re el papi ese esta re bueno… ojala estese conmigo

  • me entanta fall out boy pero me gustaria verlo entero y mas si es el cantante

  • Lucía

    Este si que es un mino con la tremenda …………
    Se ve que está muy rico jajajajajajaja…

  • jaleo

    Esto cada vez parece más el meetic. Qué de descastado buscando apoyadura en una fotito. Y la mitad no ha escuchado el disco, seguro…

  • esta oto esta muy caliente ademas,pete esta
    re fuerte y es re sexsy

  • Mani

    UUUU onda asi la pollita rewenazzzaaaaa me calentaste tanto ke parti a comprar el disco… de onde … en too caso wenaa la cosaa…mmmm!! ñomiñomi…jaajaj xP

  • amiga de mani

    media polla!!!superpolla!!!!el disco la incluye? o se vende por separado???la mani necesita que alguien le sake las telarañas!!!!jajajajaja

  • Mani

    wenas poss el SUPERPOLLA jaja como SUPERPOLLA no hay (8) jaja = ta weenaaa …… D ke me compro el CD….jaja tay DABLE cuurooo …(babas)

  • Cesar

    Este es el poster mas chido de Morrissey que e visto, me pregunto donde puedo conseguir uno igual???
    Y en cuanto al bajista de “FALL OUT BOY” estoy de acuerdo con varios de los comentarios sobre su verga la tiene muy buena a mi tambien me gustaria mamarsela……..yo se que a muchos batos de por aki tambien pero tienen miedo a confesarlo.

  • agostina

    me parece que el grupo es una masa igual que su musica a mi personalmente me encanta.pero tb tengo que decir que pete esta buenisimo. pero yo compro sus discos xq me gustan sus temas no x verlos en bolas

  • rosa

    puxa eso si que es bueno, soy de peru XD…eso sta pa` verlo a cada rato XD ………………..O_o

  • no que fino esa foto esta fina de pana,me encanta a y me llamo veronika .que fino.

  • Ey esta super la foto… a mi me encantan estos chico,pero ahora deliro por el bajista…. claro q son delo mejor, SON LO MAXIMO,pero la foto NO ESTA nadaa MALLL….

  • Luan

    bueno este grupo es buenisimo y la foto tambien , dejo en claro q vi este postal gracias a mi prima …pero si esta de pinga ..

  • dios yo amo a ese chico le doy el culo todas las veces q me lo pidira… lo amo y con esa fotico lo amo mas todavia jejejep…! LO AMOOOOO….!

  • didier

    yo creo que la tiene muy grande, debio ser que le hizieron un fotoestudio, yo soy gay y pienso que esta super bueno y la musica de grupo me fascina

  • lili

    humm, me fascina pete, pero esa foto??
    -.-”

    en fin…. me sigue gustando el grupo :-D
    pueden llegar mas lejos

  • berenice

    ASH OSE ESTO ES DE LO MEJOR!!!!!!!!!!!!!!ATT:BERE_123321@HOTMAIL.COM A LOS K LES GUSTE FALL OUT BOY Agregenme!!!!!!!!!!!!!!!!!!!!!!!!!

  • j

    hey chango no te pongas en pelotas ok das mala imagen al grupo

  • eduardo

    mmmm esta deliciosa yo tambiewn quiera mamarla

  • ES LO MEJOR QUE HE VISTO Y ESTA MAS GRANDE QUE NO SE QUE QUE RICO

  • Helena

    hola a todos para empezar les voy a decir que el nombre completo de este chico es:peter lewis kingston wentz III Y ESTA FOTO NO FUÉ TOMADA EN UN ESTUDIO O ALGO PARECIDO SINO QUE ESTE CHICO (PETER)SE TOMO VARIAS FOTOS DESNUDO EN EL CELULAR DE SU AMIGO,afortunadamente o desafortunadamente ese celular fué robado y las fotos fueron publicadas aquí en internet por eso esta foto esta aquí si el celular no hubiera sido robado la foto sería privada y esta foto no es para hacer más famoso al grupo por verle al guitarrista el pene el grupo es chingon y punto espero que los demás integrantes del grupo agan lo mismo pero no creo ke patrick se atreva yo lo conosco muy bien

  • POR DIOS QUE COSA TAN GRANDE QUE TIENE PETEW POR DEBAJO DE SUS PANTALONES SU BIG PENIS WAO…ATTE-HELLO KITTY.AA..QUE ASCO PETEW..PERO I LOVE YOU PETE TU CARA DE BABY…..

  • kinky

    yo soy bisexual y la neta esa imagen fue de lo mas sexy aprte peter es muy sexy

  • io soi biii
    = ta bn weno …
    mii ncanta fall out boy…
    agregen al msn
    dr.loko_avril@hot…

  • waxiiToh riiko sabroso te amo eres el mas riico de fall out boy ii TiienezZ

  • mama

    es askeroso

  • pAtTyLUvpEtEWnTz!!

    AMO A PETE WENTZ !!!
    QUIEN QUIERA AGREGENME PATTY12553@HOTMAIL.COM
    BESOS
    BE D` LOVER OF A LITTLE HEATH!!!
    Y ENCUENTRA A ESA PERONA ESPECIAL!!
    BE U ALL THE TIME!!
    BESOS

  • hola!!!!!!!! peter wentz estas uper guapo y cantan super padre fall out es la ley jejejejeje

  • Carla

    hey hey
    sou uma brasileira mineirinha
    aew
    o pete wents éh gostoso d
    ele éh MEU pauzudaum…

  • pastrula

    ptm vivo enamorada de peteee esta bien riko el y su…
    pa la gente q le gustra fall out boy…gisely66@hot..

  • Oyane

    Cuantas estupideces dices, majo.

  • SeXiBoY_FrEe

    Bonjour!!!! hi soy kmilo de colombia Y LA VERDAD PETE STA COMO MUY BUENO !! COMO LE DA LA GANA, OJALA SEA GAY !!!! CREO SI, O SINO VEAN EL ULTIMO VIDEO THIS AIN´T A SCENE, IT´S AN ARM RACES, EN FIN…. AGUANTA DEMASIADO, Y POR OTRA PARTE NO SE QUE CLASE D EIMBECIL SERIA LA PERSONA QUE POR VER A ESE HEMBRO SE COMPRARIA EL CD, SERIA RIDICULO, ADEMAS FALL OUT BOY NO NECESITA DE FOTOS, L TIENEN TODO: UNA EXCVELENTE BANDA, EXCELENTES CRITICAS E INTEGRANTE SUPER HOT. QUE VIVA PETE !!!!!!!!!!

  • felipe bello

    creo q ese tipo debe ir a un medico por dios lo tiene grande y como se le ocurre hacer eso pero yo no soy uno de ellos y lo apoyo viva el desnudo 3164109988

  • the_dark

    a las q kieran un nepe como el de el yo lo tengo =)presario_darkside@hotmail.com

  • Flor

    Bueno la verdad q no pense eso de pete :(:(:(

  • ““`lo tiene como quiere “ -EL /LA Q NO ESTE DEACUREDO Q LO DIGA /SOY DE BOLIVIA Y EN MI VIDA VI SEMEJANTE MARAVILLA

  • LY

    BUENO SOY DE PERU Y RECIEN ME EMPEZO A INTERESAR ESTA BANDA Y EN ESPECIAL PETE JAJA NO PENC Q FUERA TAN LOKO PERO ESTA COMO KIERE YEAH

  • mariana

    puxa q ese chiko tiene futuro XD esta super bueno pero la verdad es q no puedo creer q se aya sacado una foto como esa………. DIOS……….PRIMERO MUERTA

  • rikardo

    wow este tipo chavo esta bien bueno y no se diga bien guapo, ase dias vi unas fotos de ellos en boxer wow, pero esta foto esta chingonsisima, bueno yo soy bisexual y la verdad si se la mamaria a peter bueno si tienen mas fotos sexis se gustan mandenmelas mi correo es punko_againstthesystem@hotmail.com soy de sinaloa, mexico

  • EvElYta

    pERDONENMEN PRO ESTa muy sexy ..! yo le perdono esa fto un poco cochina proo se ve muy BN!!! y ps igual ellos cantan muy bn !!!! y no importa k se halla tomado esa fto.!!! PROO YO LO APOLLO!! sta muy buenoo peter!! s lo mejorr! es very hot!!! ARRIBA FALL out boy!!

  • alex rafael

    hola chicos(as) la verdad ami tambien me encanta pete esta super bueno y si le andaba dando un mamadon eh con ese tamañon que rica la tiene eh ,oigan no saben donde puedo encontrar sus fotos o alguien las tiene se los agradeceria mil bye

  • waaaaaaaaaa !!!! :baba: el wn reeeeeko La kagó !!! *0* morí…x¬x

  • RAE entristecida

    como avanza el spanglish… y el SMSio!

  • estas super expectacular !!!!!!!!!
    te amo mi amor !!!!!!!!!
    fall out boy es lo maximo peter , peter !!!!!
    como kisiera probar un pokito de eso !!!

    estoy lokita, lokita x ti mi amor !!!!!!!!!!!!!!

    besitos y pontelos donde kieras !!!!!!!!!

  • haaayyyyyyyyy q riko peter !!!!!!!!!!!!!!!
    te amo mi amor !!!!!!!!!!!!!!!!!!!
    estas bn bn pero bn wenon !!!!!!!!!
    fallout boy es lo maximo !!!!!!!!!!!!!

    hay como kisieras probar aunque sea un poko de eso !!!!!!!!!!!!!

    aki hay una admirdora tuya en panamá mi amor !!!!!!!!!!!!!

  • pete estas mas riko con el tamaño de esa gaviota

  • J-KORE

    TU PENE A SIDO MUY GRANDE Y ME GUSTARIA CHUPARLO ASTA KE KEDE SECO Y TU SEMEN DEVE SER ESKISITO Y JUGOSO , ME MASTURVO PENSANDO EN TI PENE DELICIOSO CHAOOOOOOOO CUIDATE Y MASTURBATE ARTO Y AORRA SEMEN PARA MIIIIIIIII LINDO PENETRAME PRONTO AIOCITO

  • Q PEDO, PERO EL TIPO ESTA BIEN Y LO QUE SE DA A NOTAR MEJOR, YO SI LE HAGO UNA MAMADA O USTEDES NO?,
    SI TIENEN MAS FOTOS MANDENLAS PORFA A MI MAIL: adictoallcd@hotmail.com

  • julian@

    el es un apapsito y no con esto nos dejas mas q comprobado q el y su banda saben para q sirve la fama .. . . . .
    para complacernois a nosotras sus admiradoras

  • adriana

    ♥♥♥ que cosota
    me antoge un podo de leche
    peterrrr grrrr ♥♥♥
    >.

  • adriana

    leche leche !!!!
    que kiero? leche!
    cuando la kiero! ahora!
    peterrrrr grrrrr te emoooooo ♥♥♥
    peter es grande! haber si me agregan para hablar de peter
    mi correo es XoXo.A_my_chemical_romance_@hotmail.com
    bye
    peterrrrrr

  • francisco boisier

    wena peteer anotame en tu msn franci_123_9@hotmail.com eres un idolo

  • me gusta el grupo..! q buena q la mostro x q asi somoj nosotroj los homnbres…! wasango..! perolas mujeres no muestran ni mierda..! pero = sigue adelante fall out boy…! denny_15_10@hotmail.com…! pa las chicas calientes..!

  • Stefy

    Wow bueno quede asombrada con lo que hizo pete aunque m gusto pero concuerdo con que si no quieres que aparezer en fotos no te las sakes pete?????

  • gabyta

    mmmmmmmmmmmmmmm… amo a peteeeeeeeeeeeeeeeee
    me encanta esa imagen es la mejor me vale ke a muchos no les guste
    io apoio a pete porke lo amo

  • bBaRoB!!*

    pS.. desnuDo COn RoPa SE vEE biEn
    a MI mE gUstA DE iGUaL
    FoRMa ADemAS EStA sUPEr
    GuApo y aPOyO sU DEcICiON DE dESnuDArse

  • oiee!sou juju tava dando um rolé pela net quando axei exe site e vi exa fotim cara vou falar uma coisa ele doido hein colocar exa fotim na net mas mesmo assim eu amo ele!
    peteee te amooo0o0o0o0

  • rocio

    es bkn me gusto ty aparte me encanta fall out boy xk es lo mejor y el pete es el ms lindo de fall out boy ojala nunk se separen

  • emopunKz

    de que vais? fall out boy es un grupazo que te meas
    -.- pero la mayoria de la gente de spaña no teneis ni puta idea de la musica y menos los poperos reggateoneros de los cohones

    vais a juzgar a fall out boy por unas putas fotos?

    .l.
    MiireH

  • a este siempre se le nopta …acaso no vieron en mtv cuando fob presento a calle13 en los premios ..pete esta ba con un pantalon tan apreto que se notaba cuan grande es

  • q orrrible peter porq te tomas esas fotos… yo compro los cd no es por ver el pene de peter si no porq me encanta el grupo …¡¡¡fall out boy!!!! a llegado muy lejos y puede llegar a españa. osea porq dicen esas estupideses.. de elloss. ademas su musica es demaciado buena es lo mejor q hay..a demas todo el grupo hase una buenas rolas. saludosssssssssssssssssssss y besos

  • alinne

    por dios…..
    que asco..
    como tiene tanto coraje pa hacer eso
    como se toma esas fotos y en camara
    pa que too el mundo te la vea…
    a mi me gusta el es hermoso
    es bonito y too …
    pero hacer eso
    QUE ASCO!!!!!

  • alicia

    pues la verdad en lo personal a mi me encanta fallout boy y estoy de acuerdo con muchos FOB no enpeso a verder mas por esas fotos osea que tiene que ver el disco con las fotos no creo que en el disco aparescan las fotos asi q no sean tontos y claro que hay personas en españa que compran sus discos son una super banda y la verdad me encanta pete asi que dejen de decir tonterias

  • milena_1434

    ps la verdad la banda no empezo a vender por esas fotos, ellos ya llevaban bastante tiempo antes de eso la preuba es el cd Evening Out With Your Girlfriend q fue el primer primer cd q ellos sacaron al mercado mucho antes de estas fotos y con ese cd se hicieron conocer mucho es mas hicieron el tema del mundial del 98 con Hand Of God la banda es super buena no es tipica banda de vendo un cd porque si y ya no me vuelvo a esforzar para el q bien las liricas son excelentes y los integrantes de la banda estan super lindo no crean pendejadas y saquen a esta banda adelante.

  • roberto

    ami me parece que lo tiene un poco pequeño pero me gustaria mamarselo, soy bisexual y lo tengo mas grande que el con solo 17 añitos. agregenme lo bisex roberto_rinco@hotmail.com me gustan los que estan buenos y lo tengan grande y con prepusio

  • sam

    PETE!!!! ke isiste dios no lo pense de ti o…… em no te crei capas :(pero woooow soi super fan tuya y me traumo eso cuando lo vi ahora soi mas fan tuya jajaja:) bessos y te amoooooo ja aun mas con estas fotos :P

    PETE WENTZ TE AMO!!!!!!!

  • Ariana

    ahyy de verdad me encanta su musik son lo maximo los amo en espacial al guitarrista!! :):) me encantaria tambien que vinieran para caracas – veezuela pero yo se que eso es solo un sueño!!

  • PETE !!! osea te ves mas guapo ahi osea yo lo queria ver y se cumplio ahora has otra cosa mas extrovertida en otro video.

    bueno estuvo padre la imagen y te viste guapisimo .!

    TE AMO PETE WENTZ !

    ATTE.ANDREA DE WENTZ

  • osea pete my name is andrea

    I LOVE YOU

    fall out boy is beautiful.

    sigan asi.

    TE DIGO A TODOS MIS AMIGOS LES DIGO QUE ME ENCANTA PXNDX PERO NO ES ASI USTEDES SON LO MEJOR Y A ELLOS LOS TENGO QUE ENGAÑAR PORQUE SI NO NO ME ENTERO DE TODO LO QUE HABLAN SOBRE MIS AMIGAS QUE DICEN QUE NO LES GUSTA PXNDX PERO AMI USTEDES ME ENCANTAN Y PXNDX ESTA BIEN MEDIO PERO USTEDES ME ENCANTAN . I LOVE YOU FALL OUT BOY

    ATTE. YOU FAN ANDREA ,PETE

  • Angelica

    muchocho peter latienes espectacularmente grande que bello espeo que se lo metas a una muchacha es chica tendra mucha suerte

  • cOni

    porke funkiiing diice ke nO va a llegar a españaaa eeh?

  • me encanta el xene de peter y ademas me encanta FALL OUT BOY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Q VIVAN ELLOS YEEEEEEEEEEEESSSSSSSSSSSSSS

    saben

  • valentina

    amooooooooooooooooo
    a pete
    y me encanta la musik de fall out boy
    agregeme
    diablita_rik@hotmail.com
    amoooooooooooooooooooooooooooo
    a peteeeeeeeeeeeee
    te amoooooooooo

  • brenda

    estas buenazo peter BUENAZO!!!!!!

  • sebastian

    esta mas ommenos pero tampoco para mamarselo pero sip para tener sexo es lindo…………no se le puede negar

  • la pilar

    WOOOOOW!!! yo las habia visto con censura y ahora uuuf!!me exite

  • la pilar

    mi diosssssss!!!! que ricoooooo!!! ya quiero perder mi virginidad con el uffff que delicia paaapiii!!!le veo unos 15 o mas cms.ya quiero un poquito de eso MMMMMMMMMH!!!

  • reclu

    santa pasion de cristo!!! me exite al ver esta foto no lo pudo creer que sea el mismisimo PETE WENTZ pero si esta bien peludo aun asi si esta bien bueno mmmmmmmmmmm!!!

  • holaaaaaaaa buauxico kisiera ser la ke le saco esa foto se ve bien mierdaaaaaaaaa……. me dejaron con las ganas……….jajajj rockerita123_c@hotmail.com

  • brenda

    mi amor estas re-bueno!!! sin palabras>

  • Tamiithax

    son muy bueno todos los integrantes de Fall out boy
    son lo mejor……
    =)

  • osea rebisate la cabeza no puedes decir q FALL OUT BOY tenga q poner a su bajista a sacarse fotos asi pa q vendan discos
    OSEA HELLO!!!
    deberias saber q fall out boy es uno de los grupos q esta pegando mas fuerte en este momento
    a demas su musica es genial
    la raja!!!
    m encantan y recien m vine a enterar q el bajista se abia sacado foto asi
    peru son unos de los mejores grupos de musica q e escuxado

    LOS MEJORES

    FALL OUT BOY

  • ps la neta q mal q se tenga q exibir asi para bender discos aun q el tipo este esta muy guapo q lastima por q a mi me encanta esta banda

  • JUSTICA

    GRANDE FALL OUT BOY
    TE AMO PETE ESTAS MUY RICO

  • me encanta el pene de peter me encataria mamarsela y lo q mas me gustariaes q mefollara DURO para todos los amantes del sexo y q quieran follar con migo aquiesta mi msm es daniela_peter@hotmail.com ok los amo fall out boy!!!!!

  • brenda

    Pete que grandioso te veo estaz muy bueno mi amor!!!

  • brenda

    aqui les dejo mi correo para seguir hablando sobre EL GRAN PETE!bren_163@hotmail.com I LOVE YOU PETE*Q VIVA LOS FALL OUT BOY* YEAH!!!

  • gorita

    ufff!!!! nada k decir.. hace unos meses m interesado por FOB y la raja su musica lejos lo mejor!!! yo encontraba al peter de lo mas tierno y de lo mas lindo, pero ahora… las tiene todas, super bien ekipado t diré 100% sabroso!! igual no estaría mal comentar la pik. ahi va,,deguchisakana@hotmail.com FALL OUT BOY hasta el final!!!

  • Irene

    Me encanta fall out boy!!!!!y no creo q esas fotos ayan rebajado sus ventas en todo caso las subirian…. pete wentz!! el mejor!y aqel que dice que afortunadamente su musica no llega a españa yo le digo que aver si de una vez se pasan por españa de gira que te aseguro que va a tener mas fans de los que se esperan ire@tude92@hotmail.com!!

  • JOSE – DKNY

    HEYYYY!!!! PSS Q FOTO DE ESTE TIPO!!!..ESTA SUPER BIEN, LA VERDAD ESQ ESTABA PENSANDO SI HABIA UNA FOTO DE EL ASI DESNUDO..Y SI!!!… ENCONTRE ESTA!!! ES MUYY EXITANTE… PETE ESTA GUAPISIMO Y BIEN BUENO!!! ME ENCANTARIA ESTAR CON EL!!! … APARTE EL GRUPO TOCA INCRE!!.. ME ENCANTA FALL OUT BOY!!!… SU MUSICA ME APASIONA!! Y AHORA MAS Q VI SU COCK!!..AHH SOY BI..ME ENCANTA LOS CHICOS COMPLETAMENTE LOCOS Y EN FERMOS…ES DECIR…DIFERENTES, SI BUSCARA A ALGUIEN BIEN PORTADO Y COMUN, TENDRIA A LA MALDITA ARCA DE NOE EN MI AGENDA JAJAJA.. ME GUSTAN LOS CHICOS CON PETE OBVIO O COMO KID ROCK ES UN RUBIO SUCIO!! JAJA

    I WANNA SUCK THIS COCK!!!…

    **DINERO,GLAMOUR Y DESORDEN MENTAL** >

    ::: QUOD ME NUTRIT ME DESTRUIT:::

    HEY AGREGENME CHICOS!! domebaby_iguess@hotmail.com

    SEE YA!!!

  • marce

    uuuuyyy!! no conocia asi a pete pero la foto si esta buena ya quicieran muchas mamarcela la tiene bien buena y laaaaarga lo que un hombre debe de tener

  • pues ke se puede desir debio aver estado exitado el pobre su novia kisas lo dejo y kiso enseñarle una raxon por la ke se kiera kedar kon el lastyma ke tenga ke mostrar sus karnes al mundo exterior es una forma de expresarse

    aun ke no esta nada masl el typo JJjj
    PUES KE SE GANEN LASFANS SI ESO ES LO KE KIERES
    dinero

  • yely y ary

    Dioosss pete es perfecto antes nos gustaba pero ahora estamos convencidas de que es el hombre de nuestro sueños! esta bien dotado por todas partes lo amamooos…!

  • andrea

    la verdad pete esta hecho un rico… y la verdad a mi no me molesta que la enseñe. es mas me dan mas ganas de comprar su disco ademas que son buenisimos. besos

  • adriana

    k bien el chico k siga asi k no,esta nada mal

  • rocio

    yo me conpre el disco de fall out boy por k me gusta la musica no por que el bajista enseñe la polla k kereis k osdiga envidiosos jejejeje es bromaa pero aii k reconocer k el tio estaaaaaaaaaa buenisimooooooooooooooooo una escorpion

  • paola

    A SU MECHAAA!!! no sabia que la tenia taaan grande no ma… para mi que se depilo no se le ve peluda como a los demas hombres pero aun asi esta bieeeeen riiicooo

    Por cierto como dicen que se las tomo disque con un celular A LA BURGUERRR!!! las novias se dan el lujo de …. ya saben BYEEE*

  • andrea

    =o=o nunca he visto algo parecido a esto xD jajajaja ta wena foto con razon no lo mostraron en el video jajajaja weno xaoo!

  • Deberas que se pasaron. ami me encanta fall out boys pero eso que hisieron es una puerca deberas. a mi me encanta peter poro no a si.

  • sukey

    se pasaron!! el no se tomo las fotos de seguro para enseñarlas de seguro fue alguien q le cae mal pete no creen?
    uds. que piensan de lo q abra pasado para q salgan estas fotitos que mejor ni ablar dejen su mensag pero aun asi si esta bien PAPASOTE!! mmmmmmmh

  • Tania

    oh por dios q bueno!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

    esta el chavo se me cae la baba

  • joyce Way

    jajjajajajaj…..
    tamos vovi ke es el
    pete
    jajjajajja
    kede en shock =O

    x0Xº

  • POR DIOS ESO ES ASQUEROSO!!!!!!!!!!!!!!!
    NO PUEDO CREER LO QUE ACABO DE VER
    PERO CLARAMENTE SE VE QUE SE LA
    ESTA JALANDO O QUIEN SABE
    PERO NO PUEDO CREER QUE POR TOMARSE ESA
    FOTO AYAN VENDIDO MAS DISCOS!!!!!

  • SIIIIIIIIII PT ESE TAL PETE TA MAAAAAAAAAAAAS BUENO PERO PTM YO KERIA Q NADIE VEA ESO PTMR YO KERIA LLEGAR AL LUGAR Q NADIE MAS LO VIERA CSM yo soy joana de lima-Peru…………..sikieren agrenguenme y si no? ps no pe …………………PTMMMMMMMMMMMMMMMMMMMMMM CHEBERE FALL OUT BOYYYYYYYY CON PETE WENTZ PORSUPUESTO ALLA LOQ HALLA HECHO

  • no maleteen tanto a pete ps si el keria hacerlo lo hizo tanta vaina………..kien dice? q vendieron mas discos por eso naaaaaaaaaaa ellos son chebres lo maximoooo!!!!!!!!!!!me gustan y no por qlo q hicieron si no porq tocan BIEN!!!!!!!!!!!!!! PA LOS K KIEREN chikatorment_204@hotmail.com

  • huy ese man esta buenisimo, su verga y èl. esta bien gande uyyyyyyyyyyy haci es como me gusta. lindo papasitooooooooooo!!!!!!!!!!!!!!!!!

  • jenni jd

    mmm…

    pero que coño es esto, joer parece que no habeis visto a un tio en pelotas o k se la toque, por dios esque tambien le an importancia a lo que hagan los demas en su vida privada, xk eso lo hizo en su casa y no en un concierto

    niñas a ver a soltar la calentura con el xico, el amigo o solitas que tb funciona y no lo dio de coña asi que a dejar coment mas coherentes.

    decir que peter wentz a salido con cantantes muy tontitas la verdad quees lo unico que no me gusta de el, pero nose si sigue teniedo una novia que es muy wapa y buena persona pero bueno eso ya es de su vida, k sepais que este tio tiene una discografica, crea ropa con unos amigos, tambien tiene una empresa creo de maquetacion de videos o creacion, y de paso esta tocando en fall out boy……. y con sus paranohias y todo para mi eso me alusina.

    recomiendo que escheis toda su discografia, se nota la evolucion de el grupo.
    el ultimo video que han sacado esta relacionado con estas fotos, es como una pesadilla de peter donde sucede una pelea, grabaciones, fotografias, fiestas, y muerte de peter pero como ya he dixo es un sueño …… esta muy bien el video.

  • hola chavos lo neta esta chingon su poster**********
    espero que sigan asiendo mas rolas chidas los felicito***
    los quieron un chinguero

  • estas bien bueno corazon te adoro a y me encanta los fall out boy son lo maximo te quiero mucho pete te amo !!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  • kathe

    huy mi amor que rica que la tiene, quisiera ser esa mano…. no no mentira, pero si la tiene bien grande! pero eso no importa por que aun asi es un MI AMOR DELISIOSO! TE AMO PETE!!!!!!!!

  • alexis

    pues yo creo que hicieron mal en poner esas fotos en el album (disco) por que si las hubieran puesto para que se vendan sus discos estan muy equivocados por si no estan informados ya nada puede ser confidencial por que ya existe el internet yo no tengo nesesidad de comprar un disco y menos por ver la polla de pete prefiero bajarla e imprimirla y pegarla en mi recamara jajajaja que astuto soy

  • esmeralda

    wow pete si que esta grande! pero la verdad me da igual, aun asi TE AMO!!!! pero ya no hagas esas cosas. los demas de fall out boy tambien los quiero, su musica esta bien chida su musica. PETE TE AMO!!!!

  • niña mal

    no puedo creer que pete aya hecho eso , tan buen muchacho que se veia
    pero la tiene bien buena , eso si , no lo dudo , la ashlee bitch se ha de dar tacazo de ojo y mas ahi

  • bea

    que asco de foto..!! con lo guapet que es y hacerse esa foto… :@

  • q mal peter aunq no estas mal pero no te dbes de exibir asi
    unq no te tomes esas fotos te seguiriamos queriendo…estas bien guapo

  • jesuu

    que askoo!!..no pense eso de el!! …pero = sigue siendo muy lindoo!!!..den mas informacion de el!!
    bye!

  • ayyy papito estás re bueno!!!! como para darte toda la noche!!! seeeeee

  • Pitt!!!…como va a ahacer eso!!!:.. sho q pense q’ era un buen chico…no me gusta q’ te muestres haci! pones en riego tu banda!!!…. si van a ser famosos!…no hace falta q te muestres haciii!!!….nene!!… pensa antes de hacer las cosas,,, parte d e loco pareces estar necesitado….espero q no lo hagan los de mas…Chau!!!…Aguante evanescence!!!….no ams fotos pornooooos!!!!:….junior Lee!.

  • Debbie wentz

    Yo tampoco estoy de acuerdo en lo k dies k x suerte no llegan a españa,mejor dixo es una pena k no lleguen a españa xk tocan de puta madre y no han vendido mas x k pete wentz a salido desnudo ,todo lo contrario ns gusta xk tocan bien y lo valen y menos mal k hay gente en españa k los conocen .ay k reconocer k pete wentz esta buenisimo pero no x eso siempre tienen k subir las ventas.¿ a quien no le gustaria k vinieran españa para ver uno de esos conciertos espectaculares en persona? a mi si desde luego y los demas k no saben apreciar la buena musica k digan lo k les de la gana.

  • rayanni

    mio deus……como puedo ver más potos de el gato?

  • dulce

    la verdad es ke esa foto esta muy hot , si pudiera me acostaria con pete es muy lindo y su …. tambien.

  • KRYZ_AVRIL

    PUES NO ME VIENE NI ME VA LA NETA ES QUE ESTA CHIDA SU MUSICA Y SOLO ESO !!!!
    YO SE Q NADA Q VER PERO SOY FAN DE AVRIL LAVING !!! QUIEN QUIERA CHARLAR AQUI ESTA MI MSN kryz_21lavigne@hotmail.com

  • KRYZ_AVRIL

    BUENO A MI ESTO NO ME VIENE NI ME VA LA NETA ES QUE SUS ROLAS ESTAN CHIDAS Y SOLO ESO !
    YO SE QUE NADA Q VER PERO YO SOY FAN DE AVRIL LAVIGNE INTERESADOS AQUI LES DEJO MI MSN kryz_21lavigne@hotmail.com

  • Una

    El esta muy weno, y me encanta sus canciones. Pero no me imajinava ke se enrrolara tanto

  • liz =)

    wo0o0ow esta genial me encanta pete eres lo maximo pero esta un poco “peludo” no crees?… bueno aun asi me encantas FALL OUT BOY ES LO MAXIMO atte: lizand94@hotmail.com

  • alex_bi

    no mames….. esta super bueno, quiero uno asi =P
    soy gay y bi y lo ke kieras agregame poseidon_122alex.com

    soy super caliente aunque me veo inocente

  • alex_bi

    sorry era poseidon_12@alex.com………..

    esque me emocione, estoy ahora masturbandome esque tiene una de las pollas mas ricas que he visto ademas creo que su pubis es sexyyyyyyyyyyyyyyyy

    me encanta dar sexo oral bye………. OXOXOXOXOXO

  • Natalina

    Weno para empezar… la foto esta imprecionante, no es buen fotógrafo, pero pinta descarado.
    Este tipo me encanta!!!!!!!… y la musica de la banda es genial…
    (tengo que agradecer fuertemente a los productores de la serie “ONE TREE HILLS” que me dieron la oportunidad de conocerla!!!).
    Peter tiene cara de querer comerse todo, pero no creo que halla hecho algo tan extravagante solo por vender mas copias… de seguro keria ser director de marketing en alguna importante empresa!!! jeje

  • WOOOW ESAS FOTOS YO SI ME SORPRENDI AL BERLAS YA K SOY FAN DE BALL OUT BOY DESDEL 2001 CUANDO EMPESARON UN DIA BUSQUE FOTOS DE EL YO ERA CHICA TENIA COMO 11 Y BI ESAS DUJE DEMASIADO PETE WENTZ ES EL EMO MAS SEXY SI AY OTRAS FANES (SOLO MUJERES O NIÑAS)AGREGENME A YAZMIN.PATITA@HOTMAIL.COM nada de gays agregandome pork los borro

  • no se q decir q pete es un papasito pero esta ves sepaso un poco con este afiche no me parece el esta muylindo pero q tampoco se pase no me parece

  • sergio

    hola que buen grupo es FALL OUT BOY les dejo mi correo vale sergio_va9312@hotmail.com chau besos

  • solcito

    papito te parto! a todos los fans d fall out boy agregenme!!!!!!!!!

    sol_intoxicada29@hotmail.com

  • antito

    uy dios!!!!!!!!!!! que buenop que estas!!!!!!!!

    bue muy buena la foto!!!!!

    a todos los fans de FALL OUT BOY Aagregenme!!!!!!!!!!

    antito_15rc@hotmail.com

  • ME ENAMORE!!!!!

  • michelle

    ste mino sta exisito…

    es me dio ni k miino0o0o ¡¡¡

    al = k el d panic¡ at the disco ( brandon urie )

    loa malo k stos 2 son gey kreoo io ¡¡

    los vi dando s un beso …

    brandon urie kon ryan ross…

    y st miino kon el vokalista s dio un xupao ¡¡

    osea medios miino$$ … y … GEY ¡¡

    a noooo0o0o0o ¡¡¡

    me imxta un pepino k sean gey..

    peo lo k si s es k stos miinots sta n d lo weno ¡¡

    I LOVE YOU ¡¡¡

    their groups sing very…very good ¡¡

  • esta super la fotoooooooo de pete

    la verdad eske eta muy lindo

    y pues aunke no deje nada ke ver esa pik

    seguimos apoyando a fall out boy

    y mas a pete ke despues de kitarse esos anteojos

    uyyyyyyyyyyyyyy

    se ve relindo

    weno besitos

  • anDre

    wau lo primero que se me vino ala cabesa cuando bi esa foto m dije que GRANDE LO TIENE

  • que atrevdo de su parte por dios si eso hace en …. tambien lo hara en la calle

    po dios quiere ganar publicidad esto es una $%?¿$%&%$&

  • oo wn el es muy riko y me encanta tengo mi pieza llena de su poster lei su libro qiero comprarme alguna de la wea de su ropa y ahora me voi a comprar el cd xqe ya ahorre la plata xd soi de chile yo caxo qe soi su unik fans en chile xqe ak fall out boy no es muy conocido y menos el :)pero puta iwal la foto es desepcionante caxai el qe estan mino verle su coso iwal es como traumante y desepcionante pero toabia sigo siendo su fans ademas qe el es muy mino sldds agreguenme las fans de el pa hablar y intercambairnos weas xd

    m.a.k.i.i.t.a@hotmail.com

    http://www.fotolog.com/dramaticxgirl

  • O_O hasta hoy me entere de esas fotos..bub
    aaaa
    aun a see amo a pete
    pero ay ay ahora q ya mi lo mejor..lo amo mas..

    bezo
    hanna

  • katy

    ese men es muy bello pero un poco cochino
    me fasina ese men pero enserio lo tiene grande
    espero que algun dia vengan a bolivia pero que no muestre lo que en esta pagina

  • Ese chico es muy bello pero un poco asqueroso
    Me fascina ese chico pero enserio lo tiene grande
    Espero que algún día vengan a Bolivia pero que no muestre lo que en esta pagina

  • xl3

    WOW!!!!!!!!
    sin palabras WOW!!!!

  • ale.q

    FOB es un grupo genial pro esa foto??? q onda sta bn q ste bueno pro no s pra publicarlo a mi me enknta pete pro mmm dspues d eso no c q pnsar XD XD DX

  • grecia

    aiii zabian k pete no zalio de zu kaza x 3 zemanaz cx eza fot0 pero pz ez el ez azi ozea aparte sela bajar0n de zu celular es maz aparte k tiene k ze tome ezaz fotoz muy zu vida n00 dejenlo en paz… zi lez da envidia loz komprendo x k ezta zuper wuap0 pete te amo0o erez lo maxim0 me enkanta komo kantaz aparte komo tokz waauu lo maxim0 y me enkanta tu grup0 ez lo maxim0 zon loz mejorez y me enkanta tu mark de ropa ezta zuper chida …!!! y te kier0 desir k tienez un clup k ze llama el club wentz..jaja y tambn el baile petewenze y tu .. ez mio jejeje weno biiee te amo0o weno kien no? jajaj weno k sigan azi de chidoz eee weno ya biie

  • china

    mi amor te aria chupete cosita te aria too menos el aseo

    me despide dejandote un gran gran beso en el _______?

  • gabriela chumacero

    hayyyyyyyyyy el grupo esta bueno pero el baterista deja mucho que hablar heeeeeeeee pero en fin esta buenoooooooooooooooooooooooooooo bayyyyyyyyy

  • AA

    Bueno, a mi me encanta Fall out boy y me encanta Pete Wentz, aunque ya me gustaba el grupo cuando vi las fotos.
    El mismo habia dicho lo que habia pasado con esas fotos y en uno d sus videoclips lo muestra.
    Tampoco creo q haya gente q se compren los discos del grupo x q salga asi en unas fotos, yo me lo he comprado y no x eso, asi d claro. Lo que me gusta d ellos es sus canciones, etc.
    Un BESOTE a todos Muuuuuuuuuuackss!!!

  • esnaider

    son los mejores los amo

  • BRENDHA

    LO TIEN SUPR LINDO MJR Q EL D ARIEL YURIAR GAMIÑO…

  • Paola

    wow no inventes esta super bueno su cosa ojala me lo meta algun dia

  • me encanta su cancion es demaciado cuuuuuuuullllllllllllllllllllllll a mi me da igual ustedes son los mejores

  • Karen

    Esta banda me encanta y que decir del bajista Pete Wentz, estoy enamoradisima de èl, pero lo malo es que como la gente empieza a comprar màs discos solo por ver sus dotes no artisticos.

  • joanna

    no importa lo q saqen aun sigo amando a pete asi y fall ou boy
    I LOVE PETE

  • luis david godinez rodriguez

    bueno en primera todos los gay y las chicas amamos a pete y ojala publiquen las demas fotos porque dejenme decirles que queremos verlo com pletamente en pelotad simplemente ¡¡¡¡¡lo amamos¡¡¡¡¡
    eso es todo y porfa si quieren que su citio sea el favorito de muchas gentes suban las demas fotos.

  • no chinguen pinche pete se pasa el cabron jijijiji puzz apenas m vengo enterando jijiji puzz mmmm se me hace ala vez bien chido k aya hecho eso jiji y ala vez nop :( xk es como algo cochino pero aun asi me gusta el xk esta bien guapo arriva fall out boy son los mejores bye

  • hardcorita

    q sexi men y en ncima la tni grand m enkntayyyyyyy t amo mijito riko

  • SaRiTa

    I·LoVe·PeTe!

  • julieth

    me parece q esta foto no tiene nada de malo , solo q le da un poco de erotismo al grupo y proboca escucharlos yo por lo menos los apoyo en todo, a y peter es un bombon

  • Erick

    mmmmmmmmm
    pues a mi me encanta

  • MENCHAQUITA

    PETE NO IMPORTA QUE MUESTRES TU PENE COMO QUIERA ESTAS BUENISIMO

  • estela

    hola pete wnetz solo queria que sacarar mas fotos como esas para berte el pene que de seguro lo debes de tener muybueno pero de serca bye te amo

  • POBRES YO SI CREO EN QUE FUE TRAMPA PORQUE CONFIO EN ELLOS Y SE QUE NUNCA ARIAN ALGO ASI ME ENCANTA FALL OUT BOY ES LO MEJOR ATTE AGREGAME ISA_MISSMURDER24@HOTMAIL.COM

  • qeriiqOoooo!

    iO qiierOo (babaa) deah
    jajaja

  • estela

    llo si creo que es pete wnetz y quisiera que me lo metiera por el colo y me llenara de leche porque esta muy bueno su pene

  • magda julieth

    hola a todos la verdad me encanta, tanto el grupo como peter la tiene re buena y creamen me encantaria pasar unas cuantas noches en compañia de este galan,y ni q hablar me encanta el grupo y todo lo q tenga q ver con ellos quisiera tener mas informacion de ellos, son lo maximo los amo.
    espero q algun dia pueda conocerlos y sobre todo basilar con peter, q buena q la tienes peter.

  • hola a todos la foto esta super wena esta super riko el pete especial para pasar una semana con el.A la persona que tenga mas fotos de pete en desnudo mandelas al sgte correo pene110@hotmail.com

  • mariiana.!

    po0r diio0s ko0mo0 se les o0kurre to0marle una fo0to0 asii a pete wentzz.!!
    se k el estaa ermoxo wapisimoo pero no tiienen k invadirle sus kosas personaless k onda??
    petee esta sexiixixixixixixixixixmoo wapisisisiisissmo diviviviviivivvnoo.!!
    ermoxoo pero no muestren eso me da asko.”!

  • mariiana.!

    loo amoou pero no me gusta verlo komplethoo.!!!
    aunk este bn buenothee.!

  • karen

    ggggggguuuuuuuuuaaaaaaa me encanta pete y sus atributos quisira ser su amante,esposa y novia si se puede me encantas pete ojala q vengas a cancun amor

  • itzelle

    muy bien pete asi me gustas espero que visites cancun

  • alanna

    que mal plan… dejen al pobre de pete en paz no? que haga lo que se le de su regalada gana!! o no?? a parte si dicen que asco.. para que la ven.. ¬¬ dejenlos vivir en paz!!
    fall out boy es la ley!!

  • hola tu tamaño parese de un gay besos mi amiga stephy se iso la paja mirabdote

  • aiiiii esa fotoooooooo!!!!!!!!!*-*
    (babaaaaaa)
    por dios lo que es!!!!
    muy buena banda!!=D

  • lo tiene lindo

  • Diana

    bueno a mi me parese q esta de padre el y ellos tambien estan rebuenos todos y me encantas sus canciones es mas soi fans numero 1 de fall out boy los amos a todos besos

  • Waaaaaaaawwwwwww
    La VErdaD este chico esta hermosisisisimo**la envidia de los hombres siempre prevalecera!! si los hombres no fueran envidiosos se llamarían MUJERES!!!jajaja su muscica de Fall out boy esta my bién! y el chico este waw! que me sorprendió a morir tengo muchas fotos, pero ninguna como esta!

  • tamy naty y vane

    RICOOOOOOOOOOOOOOO

    paaaraaaaaaaaaaaaaaaaaaaaaaaa
    la propia

    lo agaramos y lo destrosamos

    Sabeloooooooooooo

    me lo violo

    ricooo

  • Esteban

    ESTA BIEN, TODOS LOS DE FALL OUT BOY ESTAN GUAPOS Y PETE EN ESTA PIC LO TIENE DEMASIADO GRANDE COMO ME GUSTA.
    HABER SI UN DIA LES PONGO PIC`S PARA QUE LAS VEAN SON DE EL ESTAN MEJORES QUE ESTAS.
    AQUI LES DEJO MI CORREO ES f_valencia14@hotmail.com

  • ta ke causa das pena l tiene chikita jeeeeee yo le gano

  • S.Y. G.Y. (andres)

    Bueno si la tiene rica yo estoy conectado a cada hora si me quieren escribir mi msn es andrespe_8@hot… yo se la mamaria con mucho gusto pete te amooooooooooooooooo

  • leslittha

    eriiiisss uii riki pete
    te amoooooooo

    re re amoooooooomomomommmmmmmmmmmmmmmmmmmmmmm

    aoie agreguen pozzz
    ni un dramahh

  • FOB hasta la muerte

    Pero que gilipolleces decis?? Si quiere enseñarla que lo haga es su vida!! si no te mola FOB por que opinas en este foro? tanto te aburres que vas buscando fotos de Pete Wentz en bolas por internet y apareces aqui? anda y vete a hacer algo productivo para la sociedad en vez de meterte en los asuntos ajenos y decir estupideces sobre discos que en mi opinion son la POLLA!!!

  • me encanta pate wentz es hermoso miamorrrrrrrrrr
    te amooooooooo¿

  • valen de wentz

    la verdad amo a pete pero no por las fotos si no por su cara de bebe y su bello cuerpo FOB es lo mejor ademas patrick tiene la mejos voz del mundo Y lo de las fotos no fue culpa de pete el se las tomo para una novia que tenia enese momento y simplemente un jaker se inflitro en el celular de pete y las publico de echo pete se iva a salir de la banda por eso paso una semana metido en su cuarto si salir pero se dio cuenta que abia pasado por cosas peores asi que no hablen si no saben

  • still

    Omg es de lo mejor se me io agua lña vagina y la boca :P
    como me lo imagino dentro de mi voca rico!!
    suertuda de ashlee!!!

  • Jack

    peter wents es el puto amo.tiene un estilaso k me encanta.es un ejemplo a seguir

  • pollita

    hola que pene tan grande tiene pete

  • angie wentz

    que bueno esta elte bombon no me lo pueden prestar un rato para que me aga un privado plis esta como quiere ademas q canta muy bien,me alegra que este en este grupo,se me hace un chavo muy alegre y simpatico presentenmelo

  • alberto

    Lo Tiiene Grandee Me gustaria Lamerlo

  • hOla ps esO se ve deliciOzO
    tal ves si en ese mOnentO uvieras eyaculadO se
    veria jenial bnO a ver cuandO nos
    llegamos a cOnocer y tal ves me des de
    esa cOza delicIoZA
    bnO ia me boi bai
    me lo das aaaaaaaaa
    cOjeme!!!!

  • fernanda

    bueno solo kiero dcir ke amo a
    esta banda en especial a
    pete y a patrick
    es la mejor banda aparte de
    my chemical romance
    c me hac ke esta es
    la banda gritona
    esta banda esta sp chida

  • karrro

    :O.. como ponen eso iio lo amo a el pero no tanto komo para verselo xDD
    ia listo loa mo :*

  • huuuuuuuuuuu!!!!
    PETE ESTAS MUY-MUY RICOOOOOOOOOO..
    ME VUELVES LOCA
    XAO

  • pienso que es lo mejor el grupo en general de fall out boy pero es que ese mae esta echo un rico y como ya lo pude apreciar no solo eso tiene de rico esa foto está super buenisiiiiiiiiima lo vuelvo a repetir es la mejor que puede haber no es por ser bulgar ni nada por el estilo pero no hay que negar que esta muuuuuuuuuuy bueno yo SÍ le haría todo lo que el me pidiera con mucho gusto hasta lo haría sin que él me lo pidirea

  • ESA ES LA MEJOR FOTO DE PETE ,LO AMO ,ES DEMASIADO LINDO ASI Q AUNQUE PONGAN CUALQUIER FOTO LO SEGUIRE AMANDO ,ADEMAS NO ESTA NADA MAL……PETE ERES LO MEJOR

  • PIENSO QUE EL INTEGRANTE DE FALL OUT BOY PETE WENTZ ESTA PERO ES QUE ES PASADO DE RICO Y YA NOTE QUE NO SOLO ESO TIENE DE RICO. SOY DE COSTA RICA.

  • nikole

    las minas ke son cuatikas jajaja si es un aparato reproductivo osea es la misma wea ke tiene el pololo de cada una ke se urjen tanto…
    = ta bkn la foto jajajaja

  • maxelita _ama.a.patrick

    los fans de fall out boy en chile agregenme .

    si fueran fans de fall ouyt boy se nota ke ese no es pete .
    porfavor .

  • maxelita _ama.a.patrick
  • oseaaaa k onda kn el k la subio
    k mala ondaaaaa
    i como kiera si krian k pete
    se abergonzara x k
    iban a decir ai mira ese
    o alwo asi
    poes se ekivocan x k
    a todos nos gfusto esa pic bueno al menos ami
    i eso em basta pero k mala onda
    i si es pete poes k bn oor q ia asla le tome foto
    hahahaha ok
    adios
    peteiloveu
    eres el mejor

  • fernanda

    bueno tu foto pete es ta bien nunca te aberguenses x lo que dice la gente habla mucho ok pero tu eres el mejor de todos ok no lo olvides todas te amamos

  • yo p!enso que los fall out boy son la mejor banda que ha ex!st!do en mucho t!empo me encanta su mus!k creo que pete es lindo!!! Y love pete…

    Y los que opinen lo contrario…( NO HAY PEX…)

  • bueno yo creo q pete esta bien rico ante lo queria ahjora con esta foto lo adoro me parec q es un chico muy hot

  • cHossS!!!!!!nene!!c pasn!!aunk no ta daaa mal..:-DJEJEJEJE!!!!!!!

  • pete!!M ENCANTA Y AORA MUXO MAS.Y ESO NO M CALIFIKA KOMO UNA SALIDA MENTAL,K KEDE CLARO…SIMPLEMENTE LO BEO KOMO MS ATRBIDO Y SEXI POR UN TUBO…PETE ERES MI IDOLOO!!!!!GUAPO!!!SIGAN ASI!!!:-D C SALENM LOS fall out boy!!!!:-)A TOMAR POR AY LOS MALOS CO0MENTARIOS..MS LES GUSTARIA A USTEDES SER KOMO EL …!!!!!!!!!!

  • albert

    oo dios mioo vayaa trancaa quee tienee..

    me estoy acindoo una paja aora mismoo mientraass
    estoy mirandoo la ftooo!!

    mm ke gustoo
    kerriaa mamarselaaaaa!
    argg!

    ayayy adiooss ke eyaculoooo!

  • yeru

    OHH MY GOD Q PEAZO DE ….. DIOSS X K PETE SALIO ASI NO SERAN TRUKDAS O SI???

  • Maya wentzz !!!

    bueno bueno bueno !!

    en primera… Fall Out Boy es un grupo poca madre !!!
    en segunda….Pete no por que aparesca desnudo va a ser
    un pendejo…por que es un papasito !
    y en tercera para el wey que hiso esta encuesta que
    piense un poquito no creen ? osea por que
    no por que se haya desnudado y haya enseñado eso…
    se va a vender mas el disco de la banda.
    se vende por que el grupo es chingonsisimo y tiene exito
    cantan poca madre !!
    y me vale lo que piensen de el …por que eso es lo mas natural en los hombres o que ? el wey que digo esta cosa no tiene ? supongo que no
    Pete es un chavo guapisimo y no por esta porqueria que pusieron lo va a dejar de ser !! adios !!

    att : SEÑORA WENTZ !!

  • jacson david

    fall out boy son mi grupo faborito quisiera un autografos de ustedes para poder recordarlo como unos duros de la musica i love you

  • vicky

    vean la neta asusta un poko pero k akaso nunk an visto algo asi osea k pendejada del tal ANGEL osea eres un idiota ya kisieras ser komo el y si las ensena no es tu pedo si a si k no te metas komo si estuvieses tan bno y a los k no les paresca tmbn vallan a chingar asu madre pinches idiotas sin kiaser solo joden a la gente k es mas guapa k ustedes teee aammmoo ppeeetttee y fui a tu konsierto k diste hoy en mexiko y te veas hot te amo te admiro pete

  • brenda

    amo pete fall out boy es lo mejor es tasd guepisimi pete eslomejor me encanta el grupo agregenme si quieren
    ineverbreackyourheart@hotmail.com

  • @dr!@n@ 0:)

    .-.-.-.-.-.–.-.-.-.-.-.-.-.-.-.-.–.-.-.-.-.-.-.-.-.-.–.-.-.-.-.-.-.-.-.-.-.-.-.-.–.-.-.-.-.-.-.-.-.-.–.
    PETE TE AMO!!!!!!!!!!!!
    me cag* en mi put@ madre, k papasito estas :p
    -.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.–.-.-.-.-.-.-.-.-.–.-.-.-.-.–.-.-.-.-.–.-.-.-.-.-.–.-.-.-.-.-.-.-.

    (¯`v´¯)♥
    `*.¸.*´
    ¸.♥´¸.•*¨) ¸.•*¨)
    (¸.•´ (¸.♥´ .•´ ¸¸.•¨¯`♥ I LOVE YOU PETE!!!!!!!!!!!!!!!!
    `*.¸.*´ ♥•♦

  • osea que les pasa!!!!!!!!
    fall out boy es unos de los grupos mas chingones de todos como se atreven a decir que por esa foto… venden mas discos, yo en lo personal son super fan de ese grupo y tengo su disco y no es presisamente por lo que ustedes piensan, fall out boy tiene integrantes super talentosos y no por su cuerpo o si la tiene grande.
    piensen!, si quisieran vender mas discos todos ya se hubieran tomado fotos, pete no tuvo la culpa le robaron su celular si no hubiera sido por eso esa foto no estuviera aqui. yo he ido a sus conciertos y no es cierto que se quita la ropa no sean chismosos se nota que no tienen nada que hacer mas que inventar chismes absurdos.
    escuchen sus discos y van a saber por que los venden
    aparte pete esta bien guapo no ocupa tomarse fotos para ser mas famoso y ami me encanta.
    a quien le guste fall out boy agregenme arenita_mcr@hotmail.com arriba fall out boy y pete te amoooooooo!!!!!!!!!!

  • GAbRieLiTa

    uyyy pete estas mil de bueno espero que sigas tocando tan bien como lo haces ah y no seas tan isterico como en tu ultimo video espero que el beso que le diste a esa chica luego me lo des a mi bueno cuidate mucho y eso

    anitahx__x

  • anonimo

    weno fob es lo maximo y no digan q por suerte no llega a españa por q los q no lo conocen son unos ignorantes y flaites y con respecto a pete wentz es lo mas lindo del mundo¸.♥´¸.•*¨) ¸.•*¨)
    (¸.•´ (¸.♥´ .•´ ¸¸.•¨¯`♥ I LOVE YOU PETE!!!!!!!!!!!!!!!!

  • daiana

    hola!!!!! pete como va todo bm te kiero mucho mucho jajajaj te keria decir ke yo soy de rio grande y me guatas mucho jejeje mi amiga y yo kerias aser una banda de rock tambien sos hermosos tengo 15 añitos ami me encate tu banda y tambien de panic at the disco los re kiero mucho espero ke algu dia menga para tierra del fuego por ke aca somos un monton ke le gusta fallout boy jajajj te ILOVE YOU PETE WENTZ te amo jaja

    AGUANTE
    FALL OUT BOY Y PANIC AT THE DISCO
    LOCO!!!!!!!!!

    YO DAIANA

  • karla

    NO MANCHES COMOMPUDO HACER ESO PERO UNA COSA LA VERDAD ESTA BUENISIMO AUNQUE HAYAS ECHO ESO AUN TE SIGO AMANDOOOOOOOOO!!!!!!!!!!!!!!!

  • angie

    no manches la post esta muy original, y las mujeres no lo debemos negar porque para que decimos que no, pero se ve riquisimo. ademas que esto llama la atencion para la banda.
    y saben quede mas enamorada de el despues de esta post…

  • yesi

    aaaaaaaaaaaaaaaaaaaaaahhhhh!!!!!!!!!!

  • Chika Cookie

    Hello……….. fall out boy es lo mas chingon pero esa foto nta no era necesario

    Aun ke hay ke admitirlo Pate esta bn riko mmmmm……….

  • bea

    houlaxx fall out boy para mi son lo mejor pero peter yop kero de eso q tu tienes ok

  • CLOS

    ARGGGGGGGGGGGG Q ASCO ESTE TIPO X DIOS Q PORKERIA !!!

  • ay la pelotas de pete estan bien guenas hogala y sigas asi de bunote pete
    I LOVE PETE

  • AY QUE GUENOTE ESTA PETE SUS PELOTAS STAN BIEN CHIDAS
    OJALA SIGAS ASI DE BUENOTE Q SE VALLAN ALA CHINGADA LOS DE PANIC AT DE DISC MENDIGOS JOTOTES DE QUINTA PINCHES MONOS QUE LE QUIEREN QUITAR EL PUESTO A FALL OUT BOY EL CANTANTE DE PANIC ES GUEY EL SE AOSTO CONMIGO Y AHORA SALI PANSONA POR SU MALDITA CULPA BUENO ESPERO QUE SIGAS ASI DE BUENO PETE
    I LOVE YOU

  • Chika nice

    hi¡¡¡¡¡¡¡¡ º PETE WUAAAAAAAAAAAAAAAAAA K BN MMMMMMMMMMM I LIKE YOU PERO NETA ESTAS SUPER BN AYYYYYYY AYY K GRUPO TAN CHINGON ¡¡¡¡¡¡¡¡ VUELVE A MEX. Y YA NO LE KEMES LOS HUEVOS A ….. A TU ACOMPAÑATE JAJAJA ESTUVO SUPER CHIDO YO HUBIERA HECHO LO MISMO
    TE AMO ¡¡¡¡¡ K CHAVO , ERS SUPER GRACIOSO
    SOY TU FAN NUM. 1 OKI BYE JAJAJAJA

  • kimi

    hola soy de peru bueno esta foto me impresiono waw `pete no sabia q lo tenias asi supongo q ninguna chica ba a negar q pete c b bien rico en esa foto no byeeeeeeeeee

  • dirvany

    lo amo es lindo y me encanta fall out boy espcialmente pete y ptric los amo

  • Anni Wentz

    Bueno ps kiero decirles q Pete es lo más lindo del grupo :D
    es lo mejor q he visto ^^ jajaja
    kiero conocer a gente q le gusta FALL OUT BOY
    y también MY CHEMICAL ROMANCE
    GRACIAS.
    TR_anna_hakala@hotmail.com
    BExxxos
    ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡AmO a pEtE!!!!!!!!!!!!!!!!!!

  • Nombre

    Pete teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    teamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamoteamo
    Muchisimo eres el mas guapo del grupo soy una super fan tuya porfavor nunca
    dejes de salir de hecho te fui a ver a mexico desde veracruz solo para verte
    estuvieron geniales eres lo mejor tu grupo me encanta tu estilo igual
    eres lo mejor te amo teamo teamo muchisisisismo eres genial
    xfavor nunca cambies cuidateeeeeeeeeeee bebesote hermoso!!!!!!
    miles de besos y abrazossss
    Teamooooooooooooooooooooooo=****

  • Definitivamente este es el mejor grupo de rock que puede existir en el mundo en especial Pete y Patrick son HERMOSOS esos dos tipos uuuuufffff mas lindos no podian ser porque en este mundo no exite tanta belleza pero Pete es un PAPASOTE de primera y es taaaaaaaan LINDO!!!!! lo AMO que si lo tuviera al frente lo besaria hasta desgastarme los labios…….

    ………..I LOVE PETE!!!!!!!!!!!!!!!!! Att.: Liszmar que te ama.

  • arantza (la verdadera MISS MUNDER)

    que paquete se carga peter que imagenes tan sabrosas

    jajjajajajajajajajajaja .
    definitivamente aor me gusta mas el grupo de lo q ya me gustaba antes haciendo la muy buena misica q hacen desde sus sus primeros discos tan buenas aaaa
    pues ya q binieron a mexico velven a venir e los 10 mas pedidos en el d.f a tocar en vivo .
    att: arantza la verdadera miss munder ara_knd@hotmail.com

  • ANAID

    Yo pense que eran grandes por la fama no por los encantos de Pete y si es asi se van a hacer mucho mas famosos

  • ♥Mary♥

    Bueno realmente Pete me decepciona con esa foto pero buehh como se hace pero solo xq Pete mostro su pene no me va a dejar de gustar la banda ni el OSEA para mi pete esta guapisimo y ademas un grupo no se hace bueno x mostrar a los cantantes en pelotas si no x lo q cantan … Bueno me despido desde venezuela abrazos

  • dhanhi

    nho puedo creer q sea mi pete!!

    iwal lo sigo amando

  • CLARI!

    WOW KE SEXY!!! xD

    LO AMO♥♥♥

Send this to a friend